exercism-perl5

Repository for my Perl 5 Exercism exercises
git clone git://git.samirparikh.com/exercism-perl5
Log | Files | Refs | README

nucleotide-count.t (1810B) - raw

      1 #!/usr/bin/env perl
      2 use Test2::V0;
      3 use JSON::PP;
      4 use constant JSON => JSON::PP->new;
      5 
      6 use FindBin qw<$Bin>;
      7 use lib $Bin, "$Bin/local/lib/perl5";
      8 
      9 use NucleotideCount qw<count_nucleotides>;
     10 
     11 my @test_cases = do { local $/; @{ JSON->decode(<DATA>) }; };
     12 plan 6;
     13 
     14 imported_ok qw<count_nucleotides> or bail_out;
     15 
     16 for my $case (@test_cases) {
     17   if ( $case->{expected}{error} ) {
     18     like dies( sub { count_nucleotides( $case->{input}{strand} ) } ),
     19       qr/$case->{expected}{error}/, $case->{description};
     20   }
     21   else {
     22     is count_nucleotides( $case->{input}{strand} ),
     23       $case->{expected}, $case->{description};
     24   }
     25 }
     26 
     27 __DATA__
     28 [
     29   {
     30     "description": "empty strand",
     31     "expected": {
     32       "A": 0,
     33       "C": 0,
     34       "G": 0,
     35       "T": 0
     36     },
     37     "input": {
     38       "strand": ""
     39     },
     40     "property": "nucleotideCounts"
     41   },
     42   {
     43     "description": "can count one nucleotide in single-character input",
     44     "expected": {
     45       "A": 0,
     46       "C": 0,
     47       "G": 1,
     48       "T": 0
     49     },
     50     "input": {
     51       "strand": "G"
     52     },
     53     "property": "nucleotideCounts"
     54   },
     55   {
     56     "description": "strand with repeated nucleotide",
     57     "expected": {
     58       "A": 0,
     59       "C": 0,
     60       "G": 7,
     61       "T": 0
     62     },
     63     "input": {
     64       "strand": "GGGGGGG"
     65     },
     66     "property": "nucleotideCounts"
     67   },
     68   {
     69     "description": "strand with multiple nucleotides",
     70     "expected": {
     71       "A": 20,
     72       "C": 12,
     73       "G": 17,
     74       "T": 21
     75     },
     76     "input": {
     77       "strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
     78     },
     79     "property": "nucleotideCounts"
     80   },
     81   {
     82     "description": "strand with invalid nucleotides",
     83     "expected": {
     84       "error": "Invalid nucleotide in strand"
     85     },
     86     "input": {
     87       "strand": "AGXXACT"
     88     },
     89     "property": "nucleotideCounts"
     90   }
     91 ]