commit 6f05e2607b226a9cdae9ee76e2f4a5fa8c38c40d
parent 162eb3e5be496c92c17899e418140ce7605ded4d
Author: Samir Parikh <noreply@samirparikh.com>
Date: Sat, 27 Nov 2021 16:16:50 +0000
add nucelotide-count
Diffstat:
6 files changed, 208 insertions(+), 0 deletions(-)
diff --git a/nucleotide-count/.exercism/config.json b/nucleotide-count/.exercism/config.json
@@ -0,0 +1,24 @@
+{
+ "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
+ "authors": [
+ "bentglasstube"
+ ],
+ "contributors": [
+ "kytrinyx",
+ "m-dango",
+ "rfilipo"
+ ],
+ "files": {
+ "solution": [
+ "NucleotideCount.pm"
+ ],
+ "test": [
+ "nucleotide-count.t"
+ ],
+ "example": [
+ ".meta/solutions/NucleotideCount.pm"
+ ]
+ },
+ "source": "The Calculating DNA Nucleotides_problem at Rosalind",
+ "source_url": "http://rosalind.info/problems/dna/"
+}
diff --git a/nucleotide-count/.exercism/metadata.json b/nucleotide-count/.exercism/metadata.json
@@ -0,0 +1 @@
+{"track":"perl5","exercise":"nucleotide-count","id":"67af13f8f2e24fd784b7dd2f2745e12d","url":"https://exercism.org/tracks/perl5/exercises/nucleotide-count","handle":"confidentidiot","is_requester":true,"auto_approve":false}
+\ No newline at end of file
diff --git a/nucleotide-count/HELP.md b/nucleotide-count/HELP.md
@@ -0,0 +1,35 @@
+# Help
+
+## Running the tests
+
+There is a Perl 5 script with the extension `.t`, which will be used to test
+your solution. You can run through the tests by using the command:
+
+```bash
+`prove .`
+```
+
+## Submitting your solution
+
+You can submit your solution using the `exercism submit NucleotideCount.pm` command.
+This command will upload your solution to the Exercism website and print the solution page's URL.
+
+It's possible to submit an incomplete solution which allows you to:
+
+- See how others have completed the exercise
+- Request help from a mentor
+
+## Need to get help?
+
+If you'd like help solving the exercise, check the following pages:
+
+- The [Perl 5 track's documentation](https://exercism.org/docs/tracks/perl5)
+- [Exercism's support channel on gitter](https://gitter.im/exercism/support)
+- The [Frequently Asked Questions](https://exercism.org/docs/using/faqs)
+
+Should those resources not suffice, you could submit your (incomplete) solution to request mentoring.
+
+To get help if you're having trouble, you can use one of the following resources:
+
+- [/r/perl5](https://www.reddit.com/r/perl5) is the perl5 subreddit.
+- [StackOverflow](http://stackoverflow.com/questions/tagged/perl5) can be used to search for your problem and see if it has been answered already. You can also ask and answer questions.
+\ No newline at end of file
diff --git a/nucleotide-count/NucleotideCount.pm b/nucleotide-count/NucleotideCount.pm
@@ -0,0 +1,12 @@
+package NucleotideCount;
+use strict;
+use warnings;
+use Exporter qw<import>;
+our @EXPORT_OK = qw<count_nucleotides>;
+
+sub count_nucleotides {
+ my ($strand) = @_;
+ return undef;
+}
+
+1;
diff --git a/nucleotide-count/README.md b/nucleotide-count/README.md
@@ -0,0 +1,42 @@
+# Nucleotide Count
+
+Welcome to Nucleotide Count on Exercism's Perl 5 Track.
+If you need help running the tests or submitting your code, check out `HELP.md`.
+
+## Instructions
+
+Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed. All known life depends on DNA!
+
+> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
+
+DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine. A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
+We call the order of these nucleotides in a bit of DNA a "DNA sequence".
+
+We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
+'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
+
+For example:
+
+```
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```
+
+## Source
+
+### Created by
+
+- @bentglasstube
+
+### Contributed to by
+
+- @kytrinyx
+- @m-dango
+- @rfilipo
+
+### Based on
+
+The Calculating DNA Nucleotides_problem at Rosalind - http://rosalind.info/problems/dna/
+\ No newline at end of file
diff --git a/nucleotide-count/nucleotide-count.t b/nucleotide-count/nucleotide-count.t
@@ -0,0 +1,91 @@
+#!/usr/bin/env perl
+use Test2::V0;
+use JSON::PP;
+use constant JSON => JSON::PP->new;
+
+use FindBin qw<$Bin>;
+use lib $Bin, "$Bin/local/lib/perl5";
+
+use NucleotideCount qw<count_nucleotides>;
+
+my @test_cases = do { local $/; @{ JSON->decode(<DATA>) }; };
+plan 6;
+
+imported_ok qw<count_nucleotides> or bail_out;
+
+for my $case (@test_cases) {
+ if ( $case->{expected}{error} ) {
+ like dies( sub { count_nucleotides( $case->{input}{strand} ) } ),
+ qr/$case->{expected}{error}/, $case->{description};
+ }
+ else {
+ is count_nucleotides( $case->{input}{strand} ),
+ $case->{expected}, $case->{description};
+ }
+}
+
+__DATA__
+[
+ {
+ "description": "empty strand",
+ "expected": {
+ "A": 0,
+ "C": 0,
+ "G": 0,
+ "T": 0
+ },
+ "input": {
+ "strand": ""
+ },
+ "property": "nucleotideCounts"
+ },
+ {
+ "description": "can count one nucleotide in single-character input",
+ "expected": {
+ "A": 0,
+ "C": 0,
+ "G": 1,
+ "T": 0
+ },
+ "input": {
+ "strand": "G"
+ },
+ "property": "nucleotideCounts"
+ },
+ {
+ "description": "strand with repeated nucleotide",
+ "expected": {
+ "A": 0,
+ "C": 0,
+ "G": 7,
+ "T": 0
+ },
+ "input": {
+ "strand": "GGGGGGG"
+ },
+ "property": "nucleotideCounts"
+ },
+ {
+ "description": "strand with multiple nucleotides",
+ "expected": {
+ "A": 20,
+ "C": 12,
+ "G": 17,
+ "T": 21
+ },
+ "input": {
+ "strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+ },
+ "property": "nucleotideCounts"
+ },
+ {
+ "description": "strand with invalid nucleotides",
+ "expected": {
+ "error": "Invalid nucleotide in strand"
+ },
+ "input": {
+ "strand": "AGXXACT"
+ },
+ "property": "nucleotideCounts"
+ }
+]
